# Utilizing GROMACS Simulation Files for DNA Structure Analysis with the biobb\_dna Package
**URL:** https://ask.bioexcel.eu/t/utilizing-gromacs-simulation-files-for-dna-structure-analysis-with-the-biobb-dna-package/5003
**Category:** BioBB
**Tags:** gromacs
**Created:** [May 13, 2024, 3:20pm UTC](https://ask.bioexcel.eu/t/utilizing-gromacs-simulation-files-for-dna-structure-analysis-with-the-biobb-dna-package/5003 "2024-05-13T15:20:53Z")
**Posts on this page:** 12
**Page:** 1
### Author:  [@fatemeh](https://ask.bioexcel.eu/u/fatemeh)
#### Post date: [May 13, 2024, 3:20pm UTC](https://ask.bioexcel.eu/t/utilizing-gromacs-simulation-files-for-dna-structure-analysis-with-the-biobb-dna-package/5003/1 "2024-05-13T15:20:53Z")
Hello, I would like to use `biobb_dna` to analyze the DNA structure. I have used GROMACS, so I have `.tpr` and `.xtc` files. Can I use these files with `biobb_dna` ?
thank you in advance
---
### Author:  [@adam.hospital](https://ask.bioexcel.eu/u/adam.hospital)
#### Post date: [May 13, 2024, 3:56pm UTC](https://ask.bioexcel.eu/t/utilizing-gromacs-simulation-files-for-dna-structure-analysis-with-the-biobb-dna-package/5003/2 "2024-05-13T15:56:13Z")
Hi fatemeh,
I think that the Curves+ available from the [Conda package](https://anaconda.org/bioconda/curves) is only compatible with mdcrd and netcdf formats. I would convert the xtc file to netcdf (using some tool like the [mdtraj mdconvert](https://www.mdtraj.org/development/mdconvert.html)) and then use a pdb and the netcdf files as input for the biobb\_dna workflow.
Please contact us if you have any problem running the workflow.
Regards,
-Adam-
---
### Author:  [@fatemeh](https://ask.bioexcel.eu/u/fatemeh)
#### Post date: [May 13, 2024, 4:28pm UTC](https://ask.bioexcel.eu/t/utilizing-gromacs-simulation-files-for-dna-structure-analysis-with-the-biobb-dna-package/5003/3 "2024-05-13T16:28:39Z")
> [@adam.hospital](#):
>
> pdb
I highly appreciate your prompt reply. biobb\_dna is fantastic. It would be great if it could support GROMACS directly because Amber cannot be used for long simulations and I have to run my analysis with biobb\_dna. My .xtc files are pretty big, around 4GB. Do you think biobb\_dna can support this?
To be sure, I think I should upload .tpr or .top files instead of a .pdb file?!
---
### Author:  [@adam.hospital](https://ask.bioexcel.eu/u/adam.hospital)
#### Post date: [May 14, 2024, 11:15am UTC](https://ask.bioexcel.eu/t/utilizing-gromacs-simulation-files-for-dna-structure-analysis-with-the-biobb-dna-package/5003/4 "2024-05-14T11:15:39Z")
Hi Fatemeh,
in order to help you I would need to understand how you are using biobb\_dna. Are you using our workflows through Jupyter Notebooks, pure python or are you maybe using our [biobb\_wfs web server](https://mmb.irbbarcelona.org/biobb-wfs/)?
Thanks,
-Adam-
---
### Author:  [@fatemeh](https://ask.bioexcel.eu/u/fatemeh)
#### Post date: [May 14, 2024, 11:55am UTC](https://ask.bioexcel.eu/t/utilizing-gromacs-simulation-files-for-dna-structure-analysis-with-the-biobb-dna-package/5003/5 "2024-05-14T11:55:01Z")
> [@fatemeh](#):
>
> My .xtc files are pretty big, around 4GB. Do you think biobb\_
Thank you so much for your assistance. Working with Jupyter has become much easier for me, and I am now able to use Jupyter on the supercomputer. If I can use biobb\_dna on the supercomputer for GROMACS, it will be fascinating.
Thank you again for your help
best regrads,
Fatemeh,
---
### Author:  [@adam.hospital](https://ask.bioexcel.eu/u/adam.hospital)
#### Post date: [May 14, 2024, 12:22pm UTC](https://ask.bioexcel.eu/t/utilizing-gromacs-simulation-files-for-dna-structure-analysis-with-the-biobb-dna-package/5003/6 "2024-05-14T12:22:33Z")
Hi Fatemeh,
ok, so if you are using the Jupyter notebook, then you just need to first convert your trajectory file (.xtc) to a biobb\_dna compatible format like netcdf (.nc). This conversion can be done regardless of the MD engine used to generate the trajectory, it is just a format conversion. There are many available tools that can help you with this process (e.g. MDTraj-mdconvert). Then you can use the netcdf trajectory and a PDB as inputs for the [biobb\_dna workflow](https://github.com/bioexcel/biobb_wf_dna_helparms) (again, no worries about using a PDB as a topology for this particular workflow, Curves+ should work fine with a PDB file as input).
Hope it helps!
-Adam-
---
### Author:  [@fatemeh](https://ask.bioexcel.eu/u/fatemeh)
#### Post date: [May 14, 2024, 12:32pm UTC](https://ask.bioexcel.eu/t/utilizing-gromacs-simulation-files-for-dna-structure-analysis-with-the-biobb-dna-package/5003/7 "2024-05-14T12:32:10Z")
sure, I will try it. thank you so much.
---
### Author:  [@fatemeh](https://ask.bioexcel.eu/u/fatemeh)
#### Post date: [May 15, 2024, 12:41pm UTC](https://ask.bioexcel.eu/t/utilizing-gromacs-simulation-files-for-dna-structure-analysis-with-the-biobb-dna-package/5003/8 "2024-05-15T12:41:51Z")
Hello,
Please accept my apologies. I converted an XTC file to NC and a GRO file to a PDB file. I have a few questions:
1. The DNA molecule has 90 base pairs, but it seems that the Biobb\_dna tool only considers the following base pairs:
CCCATTGTCGCCTTGCACCGTTCATATGTTATCGGGACTCTGGTGTCTCA
Does this mean that it does not consider the entire sequence?
2)I only change the following in the script
Input parameters
seq = “CCCATTGTCGCCTTGCACCGTTCATATGTTATCGGGACTCTGGTGTCTCACCCATGGGATGTCGTAACCTTAGCACGATCAGGGGTCGTC”
seq\_comp = “GACGACCCCTGATCGTGCTAAGGTTACGACATCCCATGGGTGAGACACCAGAGTCCCGATAACATATGAACGGTGCAAGGCGACAATGGG”
and
prop = {
‘s1range’ : ‘1:90’,
‘s2range’ : ‘180:91’
please let me know if i have to change something.
3)I encountered the following error message:
Error: /miniconda3/envs/biobb\_dna\_env/lib/python3.9/site-packages/biobb\_common/tools/file\_utils.py:771:
UserWarning: biobb\_dna.curvesplus.biobb\_curves input\_top\_path:only\_DNA\_str\_90.pdb extension is not in the
valid extensions list: [‘top’]. If you want to suppress this message, please set the check\_extensions
property to False
Thank you in advance.
Best regards,
Fatemeh,
---
### Author:  [@adam.hospital](https://ask.bioexcel.eu/u/adam.hospital)
#### Post date: [May 21, 2024, 1:27pm UTC](https://ask.bioexcel.eu/t/utilizing-gromacs-simulation-files-for-dna-structure-analysis-with-the-biobb-dna-package/5003/9 "2024-05-21T13:27:18Z")
Hi Fatemeh,
1. I think this should be solved using the **biobb\_canal** `'sequence'` property.
2. It seems correct.
3. This is a mistake we introduced in the latest versions of the **biobb** library. We should include the **PDB** format as an accepted format here. From now, please use the property `'check_extensions'` as stated in the warning text like this:
```auto
from biobb_dna.curvesplus.biobb_curves import biobb_curves
curves_out_lis = "curves.out.lis"
curves_out_cda = "curves.out.cda"
prop = {
's1range' : '1:56',
's2range' : '112:57',
'check_extension' : False
}
biobb_curves(
input_struc_path=traj,
input_top_path=pdb,
output_lis_path=curves_out_lis,
output_cda_path=curves_out_cda,
properties=prop
)
```
A new [issue](https://github.com/bioexcel/biobb_dna/issues/4) has been created in the **biobb\_dna** repository to fix this problem. Thank you very much for your feedback!
Hope it helps!
-Adam-
---
### Author:  [@fatemeh](https://ask.bioexcel.eu/u/fatemeh)
#### Post date: [May 21, 2024, 3:44pm UTC](https://ask.bioexcel.eu/t/utilizing-gromacs-simulation-files-for-dna-structure-analysis-with-the-biobb-dna-package/5003/10 "2024-05-21T15:44:00Z")
> [@adam.hospital](#):
>
> new [issue](https://github.com/bioexcel/biobb_dna/issues/4) has been cre
Hello, thank you so much for reply and assistance. I will definitely try it.
thank you again.
have a nice day.
Best regards,
fatemeh,
---
### Author:  [@fatemeh](https://ask.bioexcel.eu/u/fatemeh)
#### Post date: [August 18, 2024, 12:12pm UTC](https://ask.bioexcel.eu/t/utilizing-gromacs-simulation-files-for-dna-structure-analysis-with-the-biobb-dna-package/5003/11 "2024-08-18T12:12:24Z")
Hello,
Dear Dr. Hospital,
I think there is a problem . I applied the following changes to the Jupiter note book, but there is a problem for base pair more than 45
as you can see after 43 the twist angel is not calculated correctly. please correct me if i am wrong.in advance I apricate your assistance.
I look froward to hearing from you.
Best regards,
Fatemeh,
| 38 | AC | 29.58746667 | 5.147374541 |
| --- | --- | --- | --- |
| 39 | CA | 39.73465 | 5.525619679 |
| 40 | AT | 30.38325333 | 4.06359534 |
| 41 | TA | 38.34820333 | 6.376172085 |
| 42 | AC | 29.66947667 | 5.632445458 |
| 43 | CA | 37.50877333 | 7.04495244 |
| 44 | AG | | |
| 45 | GA | 0 | 0 |
| 46 | AT | 0 | 0 |
| 47 | TT | 113.6616133 | 72.57015102 |
| 48 | TA | 119.78377 | 65.48163868 |
| 49 | AC | 84.30679 | 130.1986493 |
| 50 | CA | 111.5992967 | 98.48160509 |
| 51 | AT | 124.00301 | 68.71755656 |
| 52 | TA | 92.43231333 | 111.706258 |
| 53 | AC | 128.6853067 | 46.20100385 |
| 54 | CA | 85.62819667 | 123.0809933 |
| 55 | AT | 128.6709 | 56.63424348 |
---
### Author:  [@adam.hospital](https://ask.bioexcel.eu/u/adam.hospital)
#### Post date: [August 19, 2024, 10:41am UTC](https://ask.bioexcel.eu/t/utilizing-gromacs-simulation-files-for-dna-structure-analysis-with-the-biobb-dna-package/5003/12 "2024-08-19T10:41:46Z")
Hi Fatemeh,
[response cloned from a previous [post](https://ask.bioexcel.eu/t/exploring-the-limitations-of-biobb-dna-in-handling-large-dna-sequences/5017/4)]
it is difficult to find the reasons of this without the trajectory file. I guess the quality check analyses (RMSd, fluctuation, HBs, etc.) are not giving any strange jumps, is that right? If so, could you please try to share the topology and trajectory files with me somehow? Maybe with an on-line file sharing service like Google drive? (I know they are big)
Looking forward to your reply.
Regards,
-Adam-