# Exploring the Limitations of biobb\_dna in Handling Large DNA Sequences
**URL:** https://ask.bioexcel.eu/t/exploring-the-limitations-of-biobb-dna-in-handling-large-dna-sequences/5017
**Category:** BioBB
**Created:** [May 18, 2024, 8:26am UTC](https://ask.bioexcel.eu/t/exploring-the-limitations-of-biobb-dna-in-handling-large-dna-sequences/5017 "2024-05-18T08:26:43Z")
**Posts on this page:** 4
**Page:** 1
### Author:  [@fatemeh](https://ask.bioexcel.eu/u/fatemeh)
#### Post date: [May 18, 2024, 8:26am UTC](https://ask.bioexcel.eu/t/exploring-the-limitations-of-biobb-dna-in-handling-large-dna-sequences/5017/1 "2024-05-18T08:26:43Z")
Hello, Can biobb\_dna support a specific length of DNA? I have 90 base pairs, but it only considers 45 base pairs during calculation.
---
### Author:  [@adam.hospital](https://ask.bioexcel.eu/u/adam.hospital)
#### Post date: [May 21, 2024, 1:14pm UTC](https://ask.bioexcel.eu/t/exploring-the-limitations-of-biobb-dna-in-handling-large-dna-sequences/5017/2 "2024-05-21T13:14:33Z")
Hi Fatemeh,
sorry for the delay in answering your question.
Yes, you should be able to use **biobb\_dna** with structures having \>45 base pairs. The trick here is to use the `'sequence'` property in the **biobb\_canal** building block. This property is a way to explicitly specify the sequence of the structure analysed. If it is not added, the block tries to automatically extract this information from the previous step (_ **biobb\_curves** _), and this works only with sequences having \< 45 base pairs (due to an internal trimming of the information written in the log files by Curves+).
So, could you please try to launch the **biobb\_canal** step using the `'sequence'` property like in this example, please:
```auto
from biobb_dna.curvesplus.biobb_canal import biobb_canal
canal_out = "canal.out.zip"
seq = "ACGTACGT" # Initialize with the corresponding sequence
prop = {
'series' : True,
'histo' : True,
'sequence' : seq
}
biobb_canal(
input_cda_file=curves_out_cda,
input_lis_file=curves_out_lis,
output_zip_path=canal_out,
properties=prop
)
```
Hope it helps!
-Adam-
---
### Author:  [@fatemeh](https://ask.bioexcel.eu/u/fatemeh)
#### Post date: [August 13, 2024, 1:25pm UTC](https://ask.bioexcel.eu/t/exploring-the-limitations-of-biobb-dna-in-handling-large-dna-sequences/5017/3 "2024-08-13T13:25:41Z")
Hello,
Dear Dr. Hospital,
I applied the following changes to the Jupyter notebook, but there is a problem with base pairs greater than 43.
from biobb\_dna.curvesplus.biobb\_canal import biobb\_canal
canal\_out = “canal.out.zip”
seq = “GATTACATACATACAGATTACATACATACAGATTACATACATACAGATTACATACATACAGATTACATACATACAGATTACATACATACA”
prop = {
‘series’ : True,
‘histo’ : True,
‘sequence’ : seq
}
biobb\_canal(
input\_cda\_file=curves\_out\_cda,
input\_lis\_file=curves\_out\_lis,
output\_zip\_path=canal\_out,
properties=prop
)
As you can see, after 43, the twist angle is not calculated correctly. The plot also looks very strange. Please correct me if I am wrong. Could you please help me solve this?
| 38 | AC | 29.58746667 | 5.147374541 |
| --- | --- | --- | --- |
| 39 | CA | 39.73465 | 5.525619679 |
| 40 | AT | 30.38325333 | 4.06359534 |
| 41 | TA | 38.34820333 | 6.376172085 |
| 42 | AC | 29.66947667 | 5.632445458 |
| 43 | CA | 37.50877333 | 7.04495244 |
| 44 | AG | | |
| 45 | GA | 0 | 0 |
| 46 | AT | 0 | 0 |
| 47 | TT | 113.6616133 | 72.57015102 |
| 48 | TA | 119.78377 | 65.48163868 |
| 49 | AC | 84.30679 | 130.1986493 |
| 50 | CA | 111.5992967 | 98.48160509 |
| 51 | AT | 124.00301 | 68.71755656 |
| 52 | TA | 92.43231333 | 111.706258 |
| 53 | AC | 128.6853067 | 46.20100385 |
| 54 | CA | 85.62819667 | 123.0809933 |
| 55 | AT | 128.6709 | 56.63424348 |
---
### Author:  [@adam.hospital](https://ask.bioexcel.eu/u/adam.hospital)
#### Post date: [August 19, 2024, 10:39am UTC](https://ask.bioexcel.eu/t/exploring-the-limitations-of-biobb-dna-in-handling-large-dna-sequences/5017/4 "2024-08-19T10:39:34Z")
Hi Fatemeh,
it is difficult to find the reasons of this without the trajectory file. I guess the quality check analyses (RMSd, fluctuation, HBs, etc.) are not giving any strange jumps, is that right? If so, could you please try to share the topology and trajectory files with me somehow? Maybe with an on-line file sharing service like Google drive? (I know they are big)
Looking forward to your reply.
Regards,
-Adam-